"james" wrote in message
...
In message , Bill Wright
writes

"james" wrote in message
...

In May 2001 I heard a news bulletin on my car radio that made me
find a lay-by to collect my reeling thoughts because my memories

[snip long irrelevant but skilfully told story about being a patient, no
different to so many of us. By gum James you can't half spin 'em!]

So you aren't an expert then? I didn't think so.

Telling a story skilfully means that I choose my words with great care. At
no time, in all my posts going back over quarter of century of posting to
the Usenet, have I ever suggested that I am an expert.

Your post was written from the standpoint of an expert in opthalmology.

Bill

"Norman Wells" wrote in message
...
james wrote:
I'm gonna talk about something that really matters: cats. They
definitely have a feeling for language and style.

No they don't. They just have a feline for it.

Oh my goodness.

Bill

james wrote:

In message , Fevric J. Glandules
writes

Or is "the Usenet" a unique Follettism that means "Usenet plus
other unrelated chat systems or bulletin boards"?

Got it one, old bean! No putting anything past you!

Trouble with this is that anybody unfamiliar with your peculiar
definition of "the Usenet" will take it to mean Usenet, and will
form the impression that you are claiming to have been posting
to Usenet since the UUCP days. Which is of course not true.

Why not just say "Usenet etc."?

james wrote:

For a non-factious reply to comment, it's a fairly well-established
convention in English that places are not dignified with the definite
article whereas things are.

And "Usenet", for whatever reason, is not.

Sn!pe wrote:

former 15 year resident of Farnham:

Ooerrr. Favourite pub?

On Sun, 6 Sep 2009 17:05:34 +0100, "Brimstone"
wrote:

james wrote:
In message , Norman Wells
writes
james wrote:
In message , Fevric J. Glandules
writes
james wrote:

It's not a regional thing, is it? I've spent a fair amount of
time in "the Surrey" (more specifically, "the Farnham") and I don't
recall a tendency to stick the definite article in front of things
that don't take it.

For a non-factious reply to comment, it's a fairly well-established
convention in English that places are not dignified with the
definite article whereas things are.

It is a 'regional' thing though. Regions are always qualified by
'the', for example the South, the Auvergne, the Severn estuary.

Good point. If I were writing dialogue, I'd certainly have a character
say of a visit to, say, London. "I'm going down to the smoke" rather
than "I'm going down to smoke."

It's all a matter of one's 'feeling' for language and style.

I'm gonna talk about something that really matters: cats. They
definitely have a feeling for language and style.

Cats don't need language, apart from being able to give instructions to
their staff.



http://wilk4.com/humor/humorm346.htm

On Sun, 6 Sep 2009 17:33:09 +0100, "Norman Wells"
wrote:

james wrote:
In message , Norman Wells
writes
james wrote:
In message , Fevric J. Glandules
writes
james wrote:

It's not a regional thing, is it? I've spent a fair amount of
time in "the Surrey" (more specifically, "the Farnham") and I don't
recall a tendency to stick the definite article in front of things
that don't take it.

For a non-factious reply to comment, it's a fairly well-established
convention in English that places are not dignified with the
definite article whereas things are.

It is a 'regional' thing though. Regions are always qualified by
'the', for example the South, the Auvergne, the Severn estuary.

Good point. If I were writing dialogue, I'd certainly have a character
say of a visit to, say, London. "I'm going down to the smoke" rather
than "I'm going down to smoke."

It's all a matter of one's 'feeling' for language and style.

I'm gonna talk about something that really matters: cats. They
definitely have a feeling for language and style.

No they don't. They just have a feline for it.


http://www.mindjolt.com/games/cat-shoot

In message , Fevric J. Glandules
writes
james wrote:

For a non-factious reply to comment, it's a fairly well-established
convention in English that places are not dignified with the definite
article whereas things are.

And "Usenet", for whatever reason, is not.

I can't imagine why you allow these hobglins of the inconsequential to
torment you. JF

On Sunday 06 September 2009 18:49, Fevric J. Glandules wrote:

james wrote:

In message , Fevric J. Glandules
writes

Or is "the Usenet" a unique Follettism that means "Usenet plus
other unrelated chat systems or bulletin boards"?

Got it one, old bean! No putting anything past you!

Trouble with this is that anybody unfamiliar with your peculiar
definition of "the Usenet" will take it to mean Usenet, and will
form the impression that you are claiming to have been posting
to Usenet since the UUCP days. Which is of course not true.

I'd be interested to know how you are so sure. There's surely not enough
information to be sure that he hasn't been posting for many years.

I've been posting to Usenet for over 25 years, but you'd need a bit of
detective work to find the earliest posts. Google has one for April 1984,
but I was actually posting earlier than that!
--
Use the BIG mirror service in the UK:
http://www.mirrorservice.org

In message , Bill Wright
writes

"james" wrote in message
...
In message , Bill Wright
writes

"james" wrote in message
...

In May 2001 I heard a news bulletin on my car radio that made me
find a lay-by to collect my reeling thoughts because my memories

[snip long irrelevant but skilfully told story about being a patient, no
different to so many of us. By gum James you can't half spin 'em!]

So you aren't an expert then? I didn't think so.

Telling a story skilfully means that I choose my words with great care. At
no time, in all my posts going back over quarter of century of posting to
the Usenet, have I ever suggested that I am an expert.

Your post was written from the standpoint of an expert
in opthalmology.

Was it really? I had no idea! I don't think I can be held responsible
for the assumptions of others. As a consequence of suffering from crap
eyesight for most of my life I've probably been informed by more eye
specialists than most people. How many people can claim that Harold
Ridley was their eye doctor in the 1950s? It seems that I've outlived
them all.

Mind you, I have sold the bible for a screen play based on his life
complete with budgetary breakdown. But that's more about a writer
practising the useful art of pulling off a confidence tricks.
--
James Follett. Novelist. (G1LXP) http://www.jamesfollett.dswilliams.co.uk

"A potent and exploitable human force is the envy of the ignorant, the idle and
the unfortunate for those who are industrious and successful." (Unknown. Might
be Fromm.)

In message , AlanG
writes
On Sun, 6 Sep 2009 17:05:34 +0100, "Brimstone"
wrote:

james wrote:
In message , Norman Wells
writes
james wrote:

I'm gonna talk about something that really matters: cats. They
definitely have a feeling for language and style.

Cats don't need language, apart from being able to give instructions to
their staff.

Heh heh. I think it was Robbie Heinlein who said: "Never pick up a
kitten unless you're prepared to be owned by it.
--
James Follett.
Http://www.pbase.com/jamesfollett
updated to include 'Wings' air and vehicle show pictures at
Dunsfold. http://www.jamesfollett.dswilliams.co.uk

AlanG wrote:

http://wilk4.com/humor/humorm346.htm

ROFLMAO

Brimstone wrote:
AlanG wrote:
http://wilk4.com/humor/humorm346.htm

ROFLMAO

Me too. :-))

That cat at the top of the link looks like my youngest g daughter when
she can't get her own way :-)

I keep telling her 'you never win with me' and it has sunk in, thank
gawd. :-)

Dave

Sn!pe wrote:
Fevric J. Glandules wrote:

Sn!pe wrote:

former 15 year resident of Farnham:
Ooerrr. Favourite pub?

That would be the Buckingham Snooker Club in Bear Lane. I lived
on Folly Hill in the early '80s, in Lower Bourne after that and then
in Churt until I eventually escaped to Winchester in '95.

Do we really need this crap in uk.diy?

Dave

james wrote:

In message , Fevric J. Glandules
writes
james wrote:

For a non-factious reply to comment, it's a fairly well-established
convention in English that places are not dignified with the definite
article whereas things are.

And "Usenet", for whatever reason, is not.

I can't imagine why you allow these hobglins of the inconsequential to
torment you. JF

I can't imagine why you think that they torment me.

In message , Dave
writes
Sn!pe wrote:
Fevric J. Glandules wrote:

Sn!pe wrote:

former 15 year resident of Farnham:
Ooerrr. Favourite pub?
That would be the Buckingham Snooker Club in Bear Lane. I lived on
Folly Hill in the early '80s, in Lower Bourne after that and then in
Churt until I eventually escaped to Winchester in '95.

Do we really need this crap in uk.diy?


Absolutely. Yes.

--
bof at bof dot me dot uk

Bob Eager wrote:

On Sunday 06 September 2009 18:49, Fevric J. Glandules wrote:

Trouble with this is that anybody unfamiliar with your peculiar
definition of "the Usenet" will take it to mean Usenet, and will
form the impression that you are claiming to have been posting
to Usenet since the UUCP days. Which is of course not true.

I'd be interested to know how you are so sure. There's surely not enough
information to be sure that he hasn't been posting for many years.

Because he's said so.

I've been posting to Usenet for over 25 years,

Jolly good.

And please don't set a follow-up without saying so in your post.
It's rude.

Sn!pe wrote:
To the original poster: Was there actually any good reason
for crossposting to uk.misc, uk.d-i-y and uk.legal?

Yes: all of the groups were relevant and likely to contain people likely
to know the answer to my question. Which many of them did.

The fact that thread drift has inevitably set in so as to
render many posts irrelevant to two of the groups is *not* my
fault, and my choice of groups was absolutely bang on.

I have also noticed before that you are someone given to petty whining.
I am confident, however, that my (unnecessary) explanation will have
allayed your inner turmoil and allowed you to see that in this case, as
in many, your whining was misplaced. With a few more years' experience
of usenet, you'll get the hang of it.

HTH.


Martin

On Sunday 06 September 2009 22:05, Fevric J. Glandules wrote:

Bob Eager wrote:

On Sunday 06 September 2009 18:49, Fevric J. Glandules wrote:

Trouble with this is that anybody unfamiliar with your peculiar
definition of "the Usenet" will take it to mean Usenet, and will
form the impression that you are claiming to have been posting
to Usenet since the UUCP days. Which is of course not true.

I'd be interested to know how you are so sure. There's surely not enough
information to be sure that he hasn't been posting for many years.

Because he's said so.

I said "hasn't", not "has". Do try and keep up.

And please don't set a follow-up without saying so in your post.
It's rude.

I didn't. You really do have trouble, don't you?
--
Use the BIG mirror service in the UK:
http://www.mirrorservice.org

Bob Eager wrote:

On Sunday 06 September 2009 22:05, Fevric J. Glandules wrote:

Bob Eager wrote:

On Sunday 06 September 2009 18:49, Fevric J. Glandules wrote:

Trouble with this is that anybody unfamiliar with your peculiar
definition of "the Usenet" will take it to mean Usenet, and will
form the impression that you are claiming to have been posting
to Usenet since the UUCP days. Which is of course not true.

I'd be interested to know how you are so sure. There's surely not enough
information to be sure that he hasn't been posting for many years.

Because he's said so.

I said "hasn't", not "has". Do try and keep up.

I'm sure he hasn't been posting to Usenet for 25 years because he
has said so himself. He was posting to *something* - CIX maybe? -
but not to Usenet.

And please don't set a follow-up without saying so in your post.
It's rude.

I didn't. You really do have trouble, don't you?

You did. You've done it again:

From: Bob Eager
Newsgroups: uk.misc,uk.d-i-y,uk.legal
Subject: Sale of Incandescent Bulbs to End on Tuesday?
Followup-To: uk.misc
Date: Sun, 06 Sep 2009 22:45:29 +0100

Please don't set a follow-up without saying so in your post.
It's rude.

In message , Sn!pe
writes

Ordinarily I put hobgoblins in my kill-file but I thought I'd turn
filtration off for a while to see if I've been missing anything.
As it turns out I haven't, because the whole of this thread's
original post has already appeared in another group that I read.
Old hands at The Usenet will of course know that multi-posting
is the mark of the newbie, cross-posting is the proper thing.
I'm really surprised that you didn't know that, JF.

I do know that. I agree with you 100 per cent. But one particular
newsgroup seem to regard proper cross-posting as a Bad Thing even though
I'm usually careful to trim the number of newsgroups to a
Usenet-compliant four. Ali in particular seems to regard me as a
candidate to have my horns cut off and my toasting fork confiscated for
favouring correct cross-posting. Out of respect for his opinions on
other matters I resort to occasional multi-posting. Wrong, I know, but
it's easier not to squabble.

--
James Follett.
Http://www.pbase.com/jamesfollett
updated to include 'Wings' air and vehicle show pictures at
Dunsfold http://www.jamesfollett.dswilliams.co.uk

"Andrew Gabriel" wrote in message
...
In article ,
"Clot" writes:
Steve Terry wrote:
By Sep 2012 new technology LED lamps should be in full production

that's just 3 years but I'd like your optimism to be true!

It's a promise the LED lighting industry has broken for every
one of the last 20 years!

There are some reasonably efficient LEDs in the lab, and
available at really stupid prices. You have to wait for patents
to age or expire before they can become consumer products though.

There really is nothing technologically on the horizon which
allows you to make a 100W [equivalent] retrofit GLS LED lamp
though. Widespread LED lighting will require new purpose-
designed luminares to solve the thermal design issues which
come with LEDs.


Yes there is, during shopping at Lidls amongst the usual low energy
bulbs i spotted some BC fitting mains LED bulbs!! £1.99 each

Steve Terry

In article ,
Steve Terry wrote:
Yes there is, during shopping at Lidls amongst the usual low energy
bulbs i spotted some BC fitting mains LED bulbs!! ?1.99 each

Are they any good??

Francis

"Francis Burton" wrote in message
...
In article ,
Steve Terry wrote:
Yes there is, during shopping at Lidls amongst the usual low energy
bulbs i spotted some BC fitting mains LED bulbs!! ?1.99 each

Are they any good??
Francis


I was in a rush doing other shopping so i didn't buy one,
next time I'm in Lidls i'll get one for experimentation

Steve Terry

In article ,
Steve Terry wrote:
bulbs i spotted some BC fitting mains LED bulbs!! ?1.99 each

Are they any good??

I was in a rush doing other shopping so i didn't buy one,
next time I'm in Lidls i'll get one for experimentation

Thanks for volunteering to try it out! I'd be interested to hear
what you think of them.

Francis

"Francis Burton" wrote in message
...
In article ,
Steve Terry wrote:
bulbs i spotted some BC fitting mains LED bulbs!! ?1.99 each

Are they any good??

I was in a rush doing other shopping so i didn't buy one,
next time I'm in Lidls i'll get one for experimentation

Thanks for volunteering to try it out! I'd be interested to hear
what you think of them.
Francis


My local lidls don't have them, but the next time I'm at the other
one i will

Meanwhile i spotted this
http://www.electronicsweekly.com/blo...rtugal-tu.html

Fecking Portugal!

As they say UK is the only third world country where you can still drink the
water

Steve Terry

In article ,
Steve Terry wrote:
Thanks for volunteering to try it out! I'd be interested to hear
what you think of them.

My local lidls don't have them, but the next time I'm at the other
one i will

Good luck.

Meanwhile i spotted this
http://www.electronicsweekly.com/blo...rtugal-tu.html

Fecking Portugal!

As they say UK is the only third world country where you can still drink the
water

Seems the Portuguese have progressive ideas about how to deal with
the 'drug problem' too.
http://www.economist.com/world/europ...ry_id=14309861

Francis

In message , Bill Wright
writes

"james" wrote in message
...
In message , Steve Terry
writes
The muscles which control the eyes' accommodation won't have to do
anything unless the objective's distance varies, and the iris muscles that
control aperture don't do much unless the ambient light levels change. And
even if those muscles do have to work, they hardly use enough energy to
challenge their supply of oxygen.

I didn't know you were a specialist in opthalmology. Or did you just compose
the above from general knowledge, using your undoubted literary skills to
make it sound as if you knew what you were talking about?

It's bull**** man, pure bull****.

Of course it is! One doesn't have to be an ophthalmologist or be a maker
of exceedingly fine flaktoids to know that those mighty muscles that
open and close the iris and tug and squeeze the lens to provide
accommodation are the most oxygen hungry muscles in the human body. I'm
very grateful to you for providing me with such an insight into your
remarkable wealth of knowledge.

Thank you for enriching my miserable zero-achieving life.

--
James Follett. 'A wise man says something because he has
something to say. A fool speaks because he has to say something.'
Teach a wise man and he will be yet wiser. Teach a fool and he
will snort, bellow and stamp his rage and make great uproar.'

In message , james
writes
In message , Bill Wright
writes

"james" wrote in message
...

and the iris muscles that
control aperture don't do much unless the ambient light levels change. And
even if those muscles do have to work, they hardly use enough energy to
challenge their supply of oxygen.

I didn't know you were a specialist in opthalmology. Or did you just compose
the above from general knowledge, using your undoubted literary skills to
make it sound as if you knew what you were talking about?

It's bull**** man, pure bull****.

If you say so.

I might add that I know the earth's distance from the sun in AU but that
doesn't make me an astronomer. I also know that the knee bone's
connected to the thigh bone but that doesn't make me an osteopath. I can
also recognise a **** when I see one but that doesn't make me
gynaecologist.

--
James Follett.

"james" wrote
I can
also recognise a **** when I see one but that doesn't make me
a gynaecologist.

--
James Follett.

That's getting remembered for re-use another time. Not bad!


Martin

On Mon, 28 Sep 2009 11:32:46 +0100, "Fleetie"
wrote:

"james" wrote
I can
also recognise a **** when I see one but that doesn't make me
a gynaecologist.

--
James Follett.

That's getting remembered for re-use another time. Not bad!


He's not a seaman either
http://images.absoluteastronomy.com/...****splice.gif

In message , Fleetie
writes
"james" wrote
I can also recognise a **** when I see one but that doesn't make me
a gynaecologist.
-- James Follett.

That's getting remembered for re-use another time. Not bad!

Ooer! I don't care what you do with my stuff but you really
mustn't do that with Mr Snipe's posts! He's terribly sensitive
about such nonsense you know.

Look how he flew into a carpet-chewing rage when I, a
noted, self-proclaimed liar, pulled a nasty stunt by
criticising the BNP!

IMO it's his condescending manner so
liberally larded with obsolete attitudes
that offends as he casts his provocative
ground-bait into the placid mill-pond that
is uk.misc. In other words, he's a troll.

With all due respect to Mr Snipe who wrote the above,
I do appreciate that my obsolete attitude in wanting to
dance on the grave of the BNP makes me a bit of a loner,
beyond the neat picket paling. If so, then so be it.

I did indeed write the above and I stand by my words. However,
I take exception to being quoted out of context from a thread
in another place. If you're going to pull stunts like that
give proper attribution or be considered deliberately
offensive, troll that you are.

--
James Follett. Novelist. (G1LXP) http://www.jamesfollett.dswilliams.co.uk
"There is perhaps no phenomenon which contains so much destructive feeling as
moral indignation, which permits envy or hate to be acted out under the guise
of virtue." (Erich Fromm)

In message , Sn!pe
writes
james wrote:

In message , Fleetie
writes
"james" wrote
I can also recognise a **** when I see one but that doesn't make me
a gynaecologist.
-- James Follett.

That's getting remembered for re-use another time. Not bad!

Ooer! I don't care what you do with my stuff but you really
mustn't do that with Mr Snipe's posts! He's terribly sensitive
about such nonsense you know.

Look how he flew into a carpet-chewing rage when I, a
noted, self-proclaimed liar, pulled a nasty stunt by
criticising the BNP!

This is a vile calumny, I have not expressed any opinion at all
regarding the BNP nor any other similar collection of proto-nazis.

I agree. It was very wrong of me and I apologise unreservedly.

It was misrepresentation which, like using personal insults,
false analogies etc, I usually try to avoid. On this occasion
I failed miserably for which I'm profoundly sorry.

--
James Follett. G1LXP
http://www.jamesfollett.dswilliams.co.uk

In message , Bill Wright
writes

"james" wrote in message
...
In message , Steve Terry
writes
The muscles which control the eyes' accommodation won't have to do
anything unless the objective's distance varies, and the iris muscles that
control aperture don't do much unless the ambient light levels change. And
even if those muscles do have to work, they hardly use enough energy to
challenge their supply of oxygen.

I didn't know you were a specialist in opthalmology.

Of course you didn't know that because I've never made such an absurd
claim. I choose my words with great care. Indeed I exercise far more
care than many mothers exercise when selecting gene pool sperm donors
for the cretinous smears of rancid toad smegma that their pus-encrusted
wombs exude into the world. JF

I was intersted to note the term "Toad Smegma". This would indicate toads
have a foreskin and are not of a jewish heritage.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT

james wrote:
In message , Bill Wright
writes
I choose my words with great care. Indeed I exercise far more
care than many mothers exercise when selecting gene pool sperm donors
for the cretinous smears of rancid toad smegma that their pus-encrusted
wombs exude into the world. JF

BUT earn them a top place in the DHSS housing list, by so doing.

serial pregnancy slag, is a career option for the terminally lazy and
shiftless, whose sole form of exercise consists in opening their legs..

Phister wrote:
I was intersted to note the term "Toad Smegma". This would indicate toads
have a foreskin and are not of a jewish heritage.

Absolutely. Toads are Pagans.

In message , Huge
writes
On 2010-08-04, james wrote:

Oh, FFS, don't you realise that nym-shifting is definitive evidence of
****-hood?

I've no idea what FFS stands for, and I don't think I know
or want to know what nym-shifting means. I suppose I could look them up
but I'm far too busy being rich, important and famous to worry about the
meanings of terms to those troubled by such inconsequential hobgoblins
and whose talent seems to be drawing themselves up to their full
intellectual height and launching attacks on my kneecaps.

--
James Follett. 'To play hardball with Follett, you need a heavy
bat.' Walter (sp?) Franke

In article ,
says...

In message , Huge
writes
On 2010-08-04, james wrote:

Oh, FFS, don't you realise that nym-shifting is definitive evidence of
****-hood?

I've no idea what FFS stands for

"for ****'s sake"


, and I don't think I know
or want to know what nym-shifting means. I suppose I could look them up
but I'm far too busy being rich, important and famous to worry about the
meanings of terms to those troubled by such inconsequential hobgoblins
and whose talent seems to be drawing themselves up to their full
intellectual height and launching attacks on my kneecaps.

On Thu, 5 Aug 2010 13:23:10 +0100, james wrote:

In message , Huge
writes
On 2010-08-04, james wrote:

Oh, FFS, don't you realise that nym-shifting is definitive evidence of
****-hood?

I've no idea what FFS stands for, and I don't think I know
or want to know what nym-shifting means. I suppose I could look them up
but I'm far too busy being rich, important and famous to worry about the
meanings of terms to those troubled by such inconsequential hobgoblins
and whose talent seems to be drawing themselves up to their full
intellectual height and launching attacks on my kneecaps.

:-) good'un!
--
Peter.
The gods will stay away
whilst religions hold sway