On 5 Aug, 10:31, Richard Evans wrote:
Graham. wrote:
I always associate Morphy Richard with pop-up toasters.

Now there is a collectable old valve radio known in the trade as the "toaster" because
of its styling, model FB10, disappointingly it was made by KB :-)

What! so it doesn't actually make toast?

At least if they made a digital radio/toaster, then it might be of some
use to some people ;-)

Although I think I'd prefer to stick to using a normal toaster. :-)

Richard E.

Dualit make DAB radio's that look like their toasters, but not a
combined appliance... :-)

http://www.dualit.com/products/audio

You could gut a radio and a toaster, and put the innards of one in the
other...

I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

http://www.argos.co.uk/webapp/wcs/st...jpg&imageText=

http://www.argos.co.uk/static/Produc...xt%3EHENRY.htm

or this:

http://www.argos.co.uk/static/Produc...xt%3EHENRY.htm

In article
,

I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

--
From KT24

Using a RISC OS computer running v5.16

In article ,
charles writes:
In article
,

I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.

--
Andrew Gabriel
[email address is not usable -- followup in the newsgroup]

In article ,
Andrew Gabriel wrote:
In article ,
charles writes:
In article
,

I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

indeed, there is a Henry's Radio shop where you describe, but the main
components shop (when I was a student) was where I described.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.

Also Proops and a few others in Tottenham Court Road, all long since
gone too.

Indeed, so ;-(

--
From KT24

Using a RISC OS computer running v5.16

On 08/08/2010 16:23, Andrew Gabriel wrote:
In ,
writes:

In article
,


I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.


Shame they are all gone, I was first introduced to that type of shop by
my father in approx 1946, I went with him to a shop in Liverpool I
cannot remember the name, it was 200yds up from the Adelphi, on the
right hand side of Brownlow hill, he purchased an R1155 receiver there,
happy days.
Cheers
Don

In article ,
Donwill wrote:
On 08/08/2010 16:23, Andrew Gabriel wrote:
In ,
writes:

In article
,


I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.


Shame they are all gone, I was first introduced to that type of shop by
my father in approx 1946, I went with him to a shop in Liverpool I
cannot remember the name, it was 200yds up from the Adelphi, on the
right hand side of Brownlow hill, he purchased an R1155 receiver there,
happy days.

Actually, on a visit to Lincoln in May, I passed such a shop - it was shut
and I didn't have the time to investigate.

--
From KT24

Using a RISC OS computer running v5.16

On Sunday, August 8th, 2010 at 19:14:15 +0100, Donwill explained:

it was 200yds up from the Adelphi, on the right hand side of Brownlow hill

Nowadays obliterated by an NCP multi-storey parking garage?

The only type of store remaining like this in Liverpool is presumably
Progressive Radio in Dale Street?

In message , Donwill
writes
On 08/08/2010 16:23, Andrew Gabriel wrote:
In ,
writes:

In article
,


I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is
now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.


Shame they are all gone, I was first introduced to that type of shop by
my father in approx 1946, I went with him to a shop in Liverpool I
cannot remember the name, it was 200yds up from the Adelphi, on the
right hand side of Brownlow hill, he purchased an R1155 receiver there,
happy days.

Memories of when Watford Electronics was a converted terraced house down
Vicarage road

--
geoff

In article ,
geoff wrote:
In message , Donwill
writes
On 08/08/2010 16:23, Andrew Gabriel wrote:
In ,
writes:

In article
,


I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is
now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.


Shame they are all gone, I was first introduced to that type of shop by
my father in approx 1946, I went with him to a shop in Liverpool I
cannot remember the name, it was 200yds up from the Adelphi, on the
right hand side of Brownlow hill, he purchased an R1155 receiver there,
happy days.

Memories of when Watford Electronics was a converted terraced house down
Vicarage road

been there

--
From KT24

Using a RISC OS computer running v5.16

and Lasky's and J W Smith of Lisle street

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT

On 8 Aug, 19:18, charles wrote:

Actually, on a visit to Lincoln in May, I passed such a shop - it was shut
and I didn't have the time to investigate.

On Steep Hill? There are two shops there opposite each other, one's a
store for the other. Fantastic place, just like the real old surplus
places used to be. Best part is talking to the people in there - there
were odd groups restoring all manner of things in odd hangars around
Lincolnshire

I was last there last year (bought as much as I could carry) and I'm
looking forward to going back in a few weeks (the Steampunk weekend at
The Lawns). I might take a wheelbarrow!

Andy Dingley wrote:

On 8 Aug, 19:18, wrote:

Actually, on a visit to Lincoln in May, I passed such a shop - it was shut
and I didn't have the time to investigate.

On Steep Hill? There are two shops there opposite each other, one's a
store for the other.

J Birkett's of course ... fond memories of spending pocket money on
LM741s, NE555s and LEDs

On Mon, 09 Aug 2010 08:30:31 +0100, Phister wrote:

and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I was the valve reconditioner...Saturday job in Brighton at their big
underground warehouse.



--
Use the BIG mirror service in the UK:
http://www.mirrorservice.org

*lightning protection* - a w_tom conductor

On Mon, 09 Aug 2010 11:04:01 +0000, Huge wrote:

On 2010-08-09, Bob Eager wrote:
On Mon, 09 Aug 2010 08:30:31 +0100, Phister wrote:

and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I was the valve reconditioner...Saturday job in Brighton at their big
underground warehouse.

How the hell do you "recondition" a valve? At least, without glass
blowing skills and a damn good vacuum pump!

Exactly.

1) Heat the electrodes up using an HF coil round the envelope, to re-
ignite what's left (if any) of the getter; makes it reasonably 'hard'
again, at least long enough to sell it.

2) Test using Mullard valve tester.

3) Clean off all old markings.

4) Print type number and TT logo on side.



--
Use the BIG mirror service in the UK:
http://www.mirrorservice.org

*lightning protection* - a w_tom conductor

In article , Bob Eager
scribeth thus
On Mon, 09 Aug 2010 11:04:01 +0000, Huge wrote:

On 2010-08-09, Bob Eager wrote:
On Mon, 09 Aug 2010 08:30:31 +0100, Phister wrote:

and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I was the valve reconditioner...Saturday job in Brighton at their big
underground warehouse.

How the hell do you "recondition" a valve? At least, without glass
blowing skills and a damn good vacuum pump!

Exactly.

1) Heat the electrodes up using an HF coil round the envelope, to re-
ignite what's left (if any) of the getter; makes it reasonably 'hard'
again, at least long enough to sell it.

2) Test using Mullard valve tester.

3) Clean off all old markings.

4) Print type number and TT logo on side.




And like we used to do with CRT's burn the heater up a bit ;!..
--
Tony Sayer

On 08/08/2010 20:26, charles wrote:

Memories of when Watford Electronics was a converted terraced house down
Vicarage road

been there


Me too. Bought my first PCB drill there.

--
Adrian C

On 9 Aug 2010 10:47:04 GMT Bob Eager wrote :
and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I used to spend many schoolboy hours looking at those ads and the GWS
catalogue dreaming about what I'd buy if I only had money.

--
Tony Bryer, Greentram: 'Software to build on' Melbourne, Australia
www.superbeam.co.uk www.eurobeam.co.uk www.greentram.com

In message , Tony Bryer
writes
On 9 Aug 2010 10:47:04 GMT Bob Eager wrote :
and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I used to spend many schoolboy hours looking at those ads and the GWS
catalogue dreaming about what I'd buy if I only had money.

There will now be a 2 minutes silence during which time those who want
to sniffle in their hankies may do so ...

--
geoff

In article
,
Andy Dingley wrote:
On 8 Aug, 19:18, charles wrote:

Actually, on a visit to Lincoln in May, I passed such a shop - it was
shut and I didn't have the time to investigate.

On Steep Hill? There are two shops there opposite each other, one's a
store for the other.

yes.

--
From KT24

Using a RISC OS computer running v5.16

In article , geoff
scribeth thus
In message , Tony Bryer
writes
On 9 Aug 2010 10:47:04 GMT Bob Eager wrote :
and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?

I used to spend many schoolboy hours looking at those ads and the GWS
catalogue dreaming about what I'd buy if I only had money.

There will now be a 2 minutes silence during which time those who want
to sniffle in their hankies may do so ...


Awww.. Remember those days, buying Practical Wireless AKA Camm's comic
and saving up for the parts writing off the Tottenham court road or
similar with the postal order, waiting for the delivery and the
excitement of making that new design and then the despair of it not
working;(..

I wish I'd have kept some of the radio receiver projects as with the
test equipment and know how I have now to see if they could have worked
anyway;

still yoof of today dunno what they've missed etc;!....
--
Tony Sayer

I think there is still a "goodies" shop in Deptford that sells
"condensers, valves etc etc" or so it says on the shop front.

Must go up into loft and get the Henry's radio catalogue from 19560s out
and the Mullard handbooks on valves and transistors

Mike

Tony Bryer wrote:
On 9 Aug 2010 10:47:04 GMT Bob Eager wrote :

and Lasky's and J W Smith of Lisle street

Anyone remember Technical Trading at 10 Tottenham Court Road? (near the
bottom, on the west side). And their big adverts on page 3 of Parctical
Wireless, etc. for Reconditioned valves?


I used to spend many schoolboy hours looking at those ads and the GWS
catalogue dreaming about what I'd buy if I only had money.

In message , m writes
I think there is still a "goodies" shop in Deptford that sells
"condensers, valves etc etc" or so it says on the shop front.

Must go up into loft and get the Henry's radio catalogue from 19560s
out and the Mullard handbooks on valves and transistors

Funny you should say that you TPB, someone sent me a link to it last
month

I'll see if I can locate it


--
geoff

TPB????

Mike (TPB?)

geoff wrote:
In message , m writes

I think there is still a "goodies" shop in Deptford that sells
"condensers, valves etc etc" or so it says on the shop front.

Must go up into loft and get the Henry's radio catalogue from 19560s
out and the Mullard handbooks on valves and transistors

Funny you should say that you TPB, someone sent me a link to it last month

I'll see if I can locate it

In message , m
writes
TPB????

Top posting *******

here's the URL

http://www.flickr.com/photos/alevadi...-22858586@N06/



Mike (TPB?)

geoff wrote:
In message , m writes

I think there is still a "goodies" shop in Deptford that sells
"condensers, valves etc etc" or so it says on the shop front.

Must go up into loft and get the Henry's radio catalogue from 19560s
out and the Mullard handbooks on valves and transistors

Funny you should say that you TPB, someone sent me a link to it last month
I'll see if I can locate it



--
geoff

We were somewhere around Barstow, on the edge of the desert, when the
drugs began to take hold. I remember Tony Bryer
saying something like:


"As a young lad I was not only excited to visit Lisle St. and
G.W.Smith to buy my components but especially to gaze upon Mr.
Smith's well endowed wife who always served at No.3! "

http://www.retinascope.co.uk/lislestreet.html

All those shops remind me of Radio Surplus (or similar) in Glasgow, at
the bottom of the Saltmarket, next to the river. Piles of stuff inside,
and trays of components formed the counters. The customer was free to
rummage, and the staff had an encyclopaedic knowledge of everything in
stock. I built several things from the bits and pieces in there - some
of them even worked.

geoff wrote:
In message , m writes

TPB????


Top posting *******

here's the URL

http://www.flickr.com/photos/alevadi...-22858586@N06/



Mike (TPB?)

geoff wrote:

SNIP



SORRY (says he shouting!)

Have changed defaults in my good old Netscape mail client!

Mike

"Donwill" wrote in message ...
On 08/08/2010 16:23, Andrew Gabriel wrote:
In ,
writes:

In article
,


I'm waiting for Numatic to bring out a 'Henry' radio, otherwise you
could customise this:

Ah! "Henry's Radio" - the shop where the Edgware Road Flyover is now.

Really? It was a few hundred yards north of the flyover when I was
last in the area, a while back.

30 years ago in my student days, half the shops in that area were
like Henry's Radio - it's the sole survivor of them.
Also Proops and a few others in Tottenham Court Road, all long since
gone too.


Shame they are all gone, I was first introduced to that type of shop by my father in approx 1946, I went with him to a shop in
Liverpool I cannot remember the name, it was 200yds up from the Adelphi, on the right hand side of Brownlow hill, he purchased an
R1155 receiver there, happy days.
Cheers
Don

There were several around the Shude Hilll area of Manchester.
My first communications Rx was an R107 which I got from Fred's shop
(G3MAX) North West Electrics opposite the Daily Express building on
Gt Ancoats St.

Prior to that I did find a dumped 1155 chassis that I dismantled to "see how
it worked".
I dread to think what I did with the oil I found in the transformers and capacitors.


--
Graham.

%Profound_observation%

it was 200yds up from the Adelphi, on the right hand side of Brownlow hill

Nowadays obliterated by an NCP multi-storey parking garage?

The only type of store remaining like this in Liverpool is presumably
Progressive Radio in Dale Street?


Perhaps he doesn't carry the same ex military stock, but Victor Wright Electronics on The Rock, Bury Lancs preserves some of the
ethic of that bygone era with boxes
of stuff outside to rummage through etc.

--
Graham.

%Profound_observation%

Lisle Street was my favourite haunt, bought No 19 set and 3cm radar dish
from G W Smith.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT

From: Phister
Date: Sat, 28 Aug 2010 Time: 20:43:33


Lisle Street was my favourite haunt, bought No 19 set and 3cm radar dish
from G W Smith.



John Birkett in Lincoln is still in business:

http://www.zyra.org.uk/birkett.htm

--
Ian